M215

From Haplowiki

M215 is the name of a mutation on the Y chromosome.

It is used as a UEP to identify the Y chromosomal clade named E-M215, which contains a large proportion of all E haplogroup male lineages.

The YCC website's nomenclature page listed as per 2002 as follows...

Mutation Name	Region/STS	Size (bp)	Site	mutation	Forward Primer	Reverse Primer	reference
M215	UTY1 exon 14	386	163	A->G	gtaaaactcagatatatacatcccatg	aaaaaaaaagaatcactatcttaacg	Underhill et al. 2001

Karafet et al. (2008) and the ISOGG "SNP Index" adds that is has a Reference SNP ID of rs2032654 and a Y-position 13977218.

Nearly all men which are positive for M215, are also positive for M35.

For this reason, the haplogroup names E-M215 and M-35 are often treated as equivalent, and are even sometimes referred to as the "M35/M215" sub-clade (e.g. Underhill et al. 2001).

For further information, see the E-M35 article.