M224
From Haplowiki
M224 is the name of a mutation on the Y chromosome.
It is used as a UEP to identify the Y chromosomal clade named "E-M224", or, in phylogenetic terms "E1b1b1a1a".
There will probably be significantly more information posted at the article named "E-M224". This article is only about the mutation.
In Onofri et al. (2006) the SNP is defined as follows...
- Primer length (nt) 34
- Minisequencing primer sequence (50'->30') Fw (T)4ACAAATTGATACACTTAACAAAGATACTTC
- Conc. (mM) 0.2
In Karafet et al. (2008) it is as follows...
- Y-position 20352687
- Forward Primer cttcaggcattattttttttggt
- Reverse Primer atagtgttccttcacctttcctt
- PCR Size(bp) 301
- Mutation T->C
- Site 193
- Reference Underhill et al. 2001
In the only study to announce a case, Shen et al. (2004) it is described as follows (citing Underhill)...
- forward cttcaggcattattttttttggt
- reverse atagtgttccttcacctttcctt
- DHPLC temp (C) 55
- SNP inGenBank ref or dbSNP(ss) AF273841.1: g.46299A4G
