M35
From Haplowiki
M35 is the name of a mutation on the Y chromosome.
It is used as a UEP to identify the Y chromosomal clade named "E-M35", or, in phylogenetic terms "E1b1b1". It contains a large proportion of all E haplogroup male lineages.
The YCC website's nomenclature page lists it as follows...
| Mutation Name | Region/STS | Size (bp) | Site | mutation | Forward Primer | Reverse Primer | reference |
| M35 | G10.72a | 513 | 168 | G->C | taagcctaaagagcagtcagag | agagggagcaatgaggaca | Underhill et al. 2001 |
Karafet et al. (2008) and the ISOGG "SNP Index" adds that is has a "Y position" of 20201091.
Despite the citation to Underhill et al. (2001), M35 was mentioned at least as early as Semino et al. 2000 and Underhill et al. 2000. It appears that Underhill et al. 2001 announced the nearly equivalent UEP, M215, and then Cruciani et al. was certainly the paper which announced the discovery of E-M215* individuals for the first.
Nearly all men which are positive for M215, are also positive for M35. For this reason, the haplogroup names E-M215 and M-35 are often treated as equivalent, and are even sometimes referred to as the "M35/M215" sub-clade (e.g. Underhill et al. 2001).
For further information, see the E-M35 article.

