V13

From Haplowiki

Jump to: navigation, search

V13 is the name of a mutation on the Y chromosome.

It is used as a UEP to identify the Y chromosomal clade named "E-V13", or, in phylogenetic terms "E1b1b1a2".

There will probably be significantly more information posted at the article named "E-V13". This article is only about the mutation.

This mutation was announced in Cruciani et al. (2006) and then further studied in Cruciani et al. (2007). This team of authors was in pursuit of such SNP mutations to define clades within E-M78 which they had already started identifying on the basis of STR haplotypes in Cruciani et al. (2004).

Because their names start with "V" the Cruciani et al. SNPs are often called the "V series".

Karafet et al. (2008) defines the mutation as follows...

Y-position 6902263

Forward and Reverse Primers atctgtagagacccaggatgc agtgtatcaacaatgcccag

PCR Size(bp) 491

Mutation G->A

Site 207

Personal tools