V6

From Haplowiki

Jump to: navigation, search

V6 is the name of a mutation on the Y chromosome.

It is used as a UEP to identify the Y chromosomal clade named "E-V6", or, in phylogenetic terms "E1b1b1e".

There will probably be significantly more information posted at the article named "E-V6". This article is only about the mutation.

This mutation was announced in Cruciani et al. (2004).

Because their names start with "V" the Cruciani et al. SNPs are often called the "V series".

Karafet et al. (2008) defines the mutation as follows...

Y-position 6992007

Forward and Reverse Primers ccttgtgagctgatggctgtc gaaaacaatgaacccagagagg

PCR Size(bp) 346

Mutation G->C

Site 110

Personal tools